zgc:172248

Ensembl ID:
ENSDARG00000018810
ZFIN ID:
ZDB-GENE-080204-65
Description:
zinc finger CCHC domain-containing protein 4 [Source:RefSeq peptide;Acc:NP_001107071]
Human Orthologue:
ZCCHC4
Human Description:
zinc finger, CCHC domain containing 4 [Source:HGNC Symbol;Acc:22917]
Mouse Orthologue:
Zcchc4
Mouse Description:
zinc finger, CCHC domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:1926046]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35292 Nonsense Mutation detected in F1 DNA During 2018
sa13878 Essential Splice Site Available for shipment Available now
sa31874 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35292
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018832 Nonsense 43 484 2 13
Genomic Location (Zv9):
Chromosome 12 (position 24019095)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22548764
GRCz11 12 22669983
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACACTTGTATTTCTCAGGACCCGCTCTGCTTTTCGAGAAAACTGGCCAC[G/T]GAGAAGAAGAAAAGGGCAGGAGGTTTTACGCGTGCTCTGCTTGTCGGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13878
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018832 Essential Splice Site 72 484 2 13
Genomic Location (Zv9):
Chromosome 12 (position 24019005)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22548674
GRCz11 12 22669893
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTGTCGGGACAGAAAAGACTGCAACTTTTTTCAGTGGGCAGACGAGAAG[G/A]TTAKTTTNCAWAACGAAAATTGAGCTTGTGTTTCTTTAACCAACGTCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31874
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018832 Nonsense 262 484 7 13
Genomic Location (Zv9):
Chromosome 12 (position 24005895)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22535769
GRCz11 12 22656988
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCGGTCAAGTTTTTTCAAGGCTTTCTGCAAGAGGAAGGAGGAGAGAAGT[T/A]AGTCATGATAACAGACCCGCCATTTGGAGGCCTGGTGAAGCCACTAGCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link