abhd3

Ensembl ID:
ENSDARG00000018809
ZFIN ID:
ZDB-GENE-040912-90
Description:
abhydrolase domain-containing protein 3 [Source:RefSeq peptide;Acc:NP_001004569]
Human Orthologue:
ABHD3
Human Description:
abhydrolase domain containing 3 [Source:HGNC Symbol;Acc:18718]
Mouse Orthologue:
Abhd3
Mouse Description:
abhydrolase domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2147183]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32857 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa32857
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023851 Essential Splice Site 170 412 3 9
Genomic Location (Zv9):
Chromosome 2 (position 11670125)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 12095221
GRCz11 2 11878820
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCCTACATTCTGCATATGGTACAGCAGAGCCGGGATCTAGGATACAGG[T/C]GAGTAGGCTAATTCACGAGTATTAATCATATCATGAGAAATGAAAATGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Sphingolipid levels: Genome-wide association study identifies novel loci associated with circulating phospho- and sphingolipid concentrations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link