zgc:136851

Ensembl ID:
ENSDARG00000018757
ZFIN ID:
ZDB-GENE-060312-34
Description:
hypothetical protein LOC562670 [Source:RefSeq peptide;Acc:NP_001035016]
Human Orthologue:
KLF5
Human Description:
Kruppel-like factor 5 (intestinal) [Source:HGNC Symbol;Acc:6349]
Mouse Orthologue:
Klf5
Mouse Description:
Kruppel-like factor 5 Gene [Source:MGI Symbol;Acc:MGI:1338056]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24010 Nonsense Available for shipment Available now
sa24009 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24010
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010900 Nonsense 246 342 2 4
Genomic Location (Zv9):
Chromosome 21 (position 37106157)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 38095195
GRCz11 21 38142901
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATGATAATGGCCCACGGTCAGGGCATCCTCACAGGGCCCAGATACAAC[C/T]GACGGAACAACCCTGAGCTGGAGAAGAGAAGGATTCATCATTGTGACTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24009
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010900 Nonsense 311 342 4 4
Genomic Location (Zv9):
Chromosome 21 (position 37093315)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 38082353
GRCz11 21 38130059
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGCGACTGGCGCTTCGCCCGCTCGGATGAACTGACGCGGCATTACCGC[A/T]AACATACCGGCGCCAAACCTTTCAAATGCATCGCCTGCAGTCGCTGCTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Pancreatic cancer: A genome-wide association study identifies pancreatic cancer susceptibility loci on chromosomes 13q22.1, 1q32.1 and 5p15.33. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link