zw10

Ensembl ID:
ENSDARG00000018738
ZFIN ID:
ZDB-GENE-040426-800
Description:
centromere/kinetochore protein zw10 homolog [Source:RefSeq peptide;Acc:NP_956435]
Human Orthologue:
ZW10
Human Description:
ZW10, kinetochore associated, homolog (Drosophila) [Source:HGNC Symbol;Acc:13194]
Mouse Orthologue:
Zw10
Mouse Description:
ZW10 homolog (Drosophila), centromere/kinetochore protein Gene [Source:MGI Symbol;Acc:MGI:1349478]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1742 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1742
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016167 Nonsense 137 771 4 16

The following transcripts of ENSDARG00000018738 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 22158441)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 23006854
GRCz11 21 23043459
KASP Assay ID:
554-1687.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAGTATCACAGGGCCTTGCAGGAAAAGAATTATGTGGTTGCYGCAAAG[C/T]AGCATGGAACAGTAAGTCGCATTCAANNNTAAATTCATTAGACCTGCTGTCAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link