
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
npnt
- Ensembl ID:
- ENSDARG00000018721
- ZFIN ID:
- ZDB-GENE-090312-201
- Description:
- nephronectin [Source:RefSeq peptide;Acc:NP_001139052]
- Human Orthologue:
- NPNT
- Human Description:
- nephronectin [Source:HGNC Symbol;Acc:27405]
- Mouse Orthologue:
- Npnt
- Mouse Description:
- nephronectin Gene [Source:MGI Symbol;Acc:MGI:2148811]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa15583 | Essential Splice Site | Available for shipment | Available now |
sa19582 | Nonsense | Available for shipment | Available now |
sa19583 | Nonsense | Available for shipment | Available now |
sa19584 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa15583
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000018469 | Essential Splice Site | 57 | 605 | 3 | 13 |
ENSDART00000134988 | None | 87 | None | 3 |
The following transcripts of ENSDARG00000018721 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 1 (position 50633239)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 49482330 GRCz11 1 50126156 - KASP Assay ID:
- 2259-1087.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CACATTTAGACGKAGCTTCCTTCTTTTTTTGTCTGGCYGTTTGTTTTGCA[G/A]CCCTCTACGTCTTAACCCGCAGAGTAATCGGGATAAGGTGTCARCCCCAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19582
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000018469 | Nonsense | 83 | 605 | 4 | 13 |
ENSDART00000134988 | Nonsense | 66 | 87 | 3 | 3 |
The following transcripts of ENSDARG00000018721 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 1 (position 50639028)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 49488119 GRCz11 1 50131945 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TACTGATGATCTTTTTGCCTACAGCGCTATGTCAGCACGGATGCAAGCAC[G/T]GAGAATGCGTGGGACCCAACAAATGCAAGTGCCATCCAGGTTATACAGGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19583
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000018469 | Nonsense | 226 | 605 | 7 | 13 |
ENSDART00000134988 | None | 87 | None | 3 |
The following transcripts of ENSDARG00000018721 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 1 (position 50678302)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 49527393 GRCz11 1 50171219 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATCTGCAAGTGCCATGACGGCTTTGACCTTCAGTACGTCAATGGGAAATA[T/A]CAGTGTACAGGTAAACATAGTGCACATTCATGGGATAGCAAGCTTTGATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19584
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000018469 | Nonsense | 281 | 605 | 9 | 13 |
ENSDART00000134988 | None | 87 | None | 3 |
The following transcripts of ENSDARG00000018721 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 1 (position 50685709)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 49534800 GRCz11 1 50178626 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATCCTCTTTGTTCTCTTTTAGCCATCCCAAAGGTGGTAATTGACCCTCCA[C/T]GACCTGGAAAGACCACACCGAGCAGCAATAACAACAAAGGCGGCAACAAA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Pulmonary function: Meta-analyses of genome-wide association studies identify multiple loci associated with pulmonary function. (View Study)
- Pulmonary function (interaction): Genome-wide joint meta-analysis of SNP and SNP-by-smoking interaction identifies novel loci for pulmonary function. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: