agtr1

Ensembl ID:
ENSDARG00000018616
ZFIN ID:
ZDB-GENE-070912-546
Description:
Novel protein similar to human angiotensin II receptor, type 1 (AGTR1) [Source:UniProtKB/TrEMBL;Acc:
Human Orthologue:
AGTR1
Human Description:
angiotensin II receptor, type 1 [Source:HGNC Symbol;Acc:336]
Mouse Orthologues:
Agtr1a, Agtr1b
Mouse Descriptions:
angiotensin II receptor, type 1a Gene [Source:MGI Symbol;Acc:MGI:87964]
angiotensin II receptor, type 1b Gene [Source:MGI Symbol;Acc:MGI:87965]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32924 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa32924
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021528 Nonsense 252 358 1 1
Genomic Location (Zv9):
Chromosome 2 (position 24702021)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25276798
GRCz11 2 24932432
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGTCTTGAACATGTTGGCTGCTGCCGCCCTGTCCTTTTTCCTTTGCTG[G/A]GCTCCCCATCAGATCTTCAACTTCATGGAGATGCTTCTCCTGCTGAAAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link