zgc:101797

Ensembl ID:
ENSDARG00000018605
ZFIN ID:
ZDB-GENE-041114-99
Description:
tektin-1 [Source:RefSeq peptide;Acc:NP_001007398]
Human Orthologue:
TEKT1
Human Description:
tektin 1 [Source:HGNC Symbol;Acc:15534]
Mouse Orthologue:
Tekt1
Mouse Description:
tektin 1 Gene [Source:MGI Symbol;Acc:MGI:1333819]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17016 Nonsense Available for shipment Available now
sa42585 Essential Splice Site Mutation detected in F1 DNA During 2018
sa14123 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17016
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041590 Nonsense 203 398 5 8
Genomic Location (Zv9):
Chromosome 15 (position 32001623)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 34014924
GRCz11 15 33872903
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NNNNNNNNNNNNNNNNNNNNNCCACATCACCTGATTTAAATRAAGGAAATTCAAGCTTTAAATA[T/A]TCCGGGTAAGATAAGAAAACATGTTTCTGTGGAAAATGTACTTCRGATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42585
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041590 Essential Splice Site 205 398 6 8
Genomic Location (Zv9):
Chromosome 15 (position 32001490)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 34015057
GRCz11 15 33873036
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCCCTATTTGATATTCATTTCACAAACCTATTTCGTTTCACTATTTCC[A/T]GAGCTGCAGTGACTCCTGAGGAGTGGGAGAGCCTGTGCAACTTAAACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14123
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041590 Nonsense 367 398 8 8
Genomic Location (Zv9):
Chromosome 15 (position 31996482)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 34020065
GRCz11 15 33878044
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTGGAACTCTCAGARTCTGAACTAAAAGCTCTAGCATACAACCARCTG[A/T]GACTGGAAGAGGAGATCCAGGTGAAGACAAACTCCCTGTACATAGACGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link