
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:101797
- Ensembl ID:
- ENSDARG00000018605
- ZFIN ID:
- ZDB-GENE-041114-99
- Description:
- tektin-1 [Source:RefSeq peptide;Acc:NP_001007398]
- Human Orthologue:
- TEKT1
- Human Description:
- tektin 1 [Source:HGNC Symbol;Acc:15534]
- Mouse Orthologue:
- Tekt1
- Mouse Description:
- tektin 1 Gene [Source:MGI Symbol;Acc:MGI:1333819]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa17016 | Nonsense | Available for shipment | Available now |
sa42585 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa14123 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa17016
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000041590 | Nonsense | 203 | 398 | 5 | 8 |
- Genomic Location (Zv9):
- Chromosome 15 (position 32001623)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 34014924 GRCz11 15 33872903 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- NNNNNNNNNNNNNNNNNNNNNCCACATCACCTGATTTAAATRAAGGAAATTCAAGCTTTAAATA[T/A]TCCGGGTAAGATAAGAAAACATGTTTCTGTGGAAAATGTACTTCRGATCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42585
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000041590 | Essential Splice Site | 205 | 398 | 6 | 8 |
- Genomic Location (Zv9):
- Chromosome 15 (position 32001490)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 34015057 GRCz11 15 33873036 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATCCCCTATTTGATATTCATTTCACAAACCTATTTCGTTTCACTATTTCC[A/T]GAGCTGCAGTGACTCCTGAGGAGTGGGAGAGCCTGTGCAACTTAAACATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14123
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000041590 | Nonsense | 367 | 398 | 8 | 8 |
- Genomic Location (Zv9):
- Chromosome 15 (position 31996482)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 34020065 GRCz11 15 33878044 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTCTGGAACTCTCAGARTCTGAACTAAAAGCTCTAGCATACAACCARCTG[A/T]GACTGGAAGAGGAGATCCAGGTGAAGACAAACTCCCTGTACATAGACGAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: