zgc:103652

Ensembl ID:
ENSDARG00000018562
ZFIN ID:
ZDB-GENE-041114-59
Description:
coatomer subunit epsilon [Source:RefSeq peptide;Acc:NP_001007365]
Human Orthologue:
COPE
Human Description:
coatomer protein complex, subunit epsilon [Source:HGNC Symbol;Acc:2234]
Mouse Orthologue:
Cope
Mouse Description:
coatomer protein complex, subunit epsilon Gene [Source:MGI Symbol;Acc:MGI:1891702]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19678 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19678
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004398 Nonsense 228 246 7 8
Genomic Location (Zv9):
Chromosome 2 (position 9297833)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 9715487
GRCz11 2 9513492
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTCTCAACTGAAAGATGCACACAAGTCGCATCCTTTTATTAAGGATTA[T/A]CTTGCTAAGGTAAGGTTTTTTAATGTGTTCTGGGACCTTGTTCTGTTTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link