slc6a9

Ensembl ID:
ENSDARG00000018534
ZFIN ID:
ZDB-GENE-050105-3
Description:
sodium- and chloride-dependent glycine transporter 1 [Source:RefSeq peptide;Acc:NP_001025244]
Human Orthologue:
SLC6A9
Human Description:
solute carrier family 6 (neurotransmitter transporter, glycine), member 9 [Source:HGNC Symbol;Acc:11
Mouse Orthologue:
Slc6a9
Mouse Description:
solute carrier family 6 (neurotransmitter transporter, glycine), member 9 Gene [Source:MGI Symbol;Ac

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39868 Nonsense Mutation detected in F1 DNA During 2018
sa19804 Nonsense Available for shipment Available now
sa19805 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39868
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077462 Nonsense 224 653 5 13
ENSDART00000098831 Nonsense 215 644 5 13
ENSDART00000123956 Nonsense 219 648 6 14
ENSDART00000126135 Nonsense 220 649 5 13
ENSDART00000128336 Nonsense 224 653 5 13
ENSDART00000137207   None 49 None 2
Genomic Location (Zv9):
Chromosome 2 (position 33123815)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 33422722
GRCz11 2 33405940
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGACGGCATTGGGAATTTTGGTGAGGTGCGTCTGCCTATCCTGGGTTG[T/A]CTGGCTGTGTCATGGTTTGTCGTGTTCCTCTGTCTTATTCGGGGAGTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19804
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077462 Nonsense 461 653 10 13
ENSDART00000098831 Nonsense 452 644 10 13
ENSDART00000123956 Nonsense 456 648 11 14
ENSDART00000126135 Nonsense 457 649 10 13
ENSDART00000128336 Nonsense 461 653 10 13
ENSDART00000137207   None 49 None 2
Genomic Location (Zv9):
Chromosome 2 (position 33129131)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 33428038
GRCz11 2 33411256
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTTTGTGATGTAGGCGGGAATTTACTGGTTGCTGCTCATGGACAACTA[C/A]GCTGCCAGTTTCTCTCTGGTCATCATCTCTTGCATTATGTGCATCTGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19805
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077462 Nonsense 562 653 12 13
ENSDART00000098831 Nonsense 553 644 12 13
ENSDART00000123956 Nonsense 557 648 13 14
ENSDART00000126135 Nonsense 558 649 12 13
ENSDART00000128336 Nonsense 562 653 12 13
ENSDART00000137207   None 49 None 2
Genomic Location (Zv9):
Chromosome 2 (position 33129607)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 33428514
GRCz11 2 33411732
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCCATGGCTTTGTCTTCTGTTATCTGTATACCTATATATGCTCTGTTC[A/T]AGATTGCCATGTCTGAAGGATCCACCTTTTTGGAGGTAAGACGTGTTCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link