zdhhc8b

Ensembl ID:
ENSDARG00000018508
ZFIN ID:
ZDB-GENE-030407-3
Description:
probable palmitoyltransferase ZDHHC8 [Source:RefSeq peptide;Acc:NP_840089]
Human Orthologue:
ZDHHC8
Human Description:
zinc finger, DHHC-type containing 8 [Source:HGNC Symbol;Acc:18474]
Mouse Orthologue:
Zdhhc8
Mouse Description:
zinc finger, DHHC domain containing 8 Gene [Source:MGI Symbol;Acc:MGI:1338012]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25292 Essential Splice Site Mutation detected in F1 DNA During 2018
sa33559 Nonsense Mutation detected in F1 DNA During 2018
sa2242 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa25292
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014252 Essential Splice Site 333 751 8 11
ENSDART00000129878 Essential Splice Site 333 751 8 11
Genomic Location (Zv9):
Chromosome 5 (position 19816611)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 17387654
GRCz11 5 17891650
KASP Assay ID:
554-7409.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGCCGATCGCTACAACCAGATCAAGAGTCAGCTGACCTCCAGTGAAGG[T/A]AAGTAGCACTATAAATCAACCGGTCACACTATGATAGTTCACCAAAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33559
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014252 Nonsense 415 751 10 11
ENSDART00000129878 Nonsense 415 751 10 11
Genomic Location (Zv9):
Chromosome 5 (position 19822252)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 17382013
GRCz11 5 17886009
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGACTATCGGAGTGCTCCTCTCCACCGAACATACCAGTCGTCCCCTTTC[C/T]AGCTGGACTCCTTTAGCACCACGTCCCGCTCCTTTAGCCTCAAACAGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2242
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014252 Nonsense 501 751 10 11
ENSDART00000129878 Nonsense 501 751 10 11
Genomic Location (Zv9):
Chromosome 5 (position 19822512)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 17381753
GRCz11 5 17885749
KASP Assay ID:
554-3202.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATGCGCTGCTCATCCGGGCGTCCCATCAATGGGGTTTCACTCACCATA[T/G]TTACCCACTAAAATGTGCCATGTTCGTGGACCCGAACTTCAACGCCATGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link