smn1

Ensembl ID:
ENSDARG00000018494
ZFIN ID:
ZDB-GENE-990715-16
Description:
Survival motor neuron protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q9W6S8]
Human Orthologues:
SMN1, SMN2
Human Descriptions:
survival of motor neuron 1, telomeric [Source:HGNC Symbol;Acc:11117]
survival of motor neuron 2, centromeric [Source:HGNC Symbol;Acc:11118]
Mouse Orthologue:
Smn1
Mouse Description:
survival motor neuron 1 Gene [Source:MGI Symbol;Acc:MGI:109257]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40538 Essential Splice Site Mutation detected in F1 DNA During 2018
sa14881 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa40538
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028099 Essential Splice Site 40 281 2 9
ENSDART00000127956 Essential Splice Site 40 280 2 11
Genomic Location (Zv9):
Chromosome 5 (position 45423501)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 43204766
GRCz11 5 43804919
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATACAGCTTTGATTAAAGCATACGATAAAGCTGTTGCATCATTCAAGG[T/G]AACAGTGATGCTTAGAAATGACACTTCAGTTTACCTTGTTTCTTTAGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14881
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028099   171 281 5 9
ENSDART00000127956 Essential Splice Site 171 280 6 11
Genomic Location (Zv9):
Chromosome 5 (position 45422863)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 43204128
GRCz11 5 43804281
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGAGAGTGATCGCTCTTTCACCCCACAGAAGTCMGGTCATGCAAAGCA[C/T]AAATCTAAAAGCAATTTTCCTATGGGACCYCCATCATGGTTTCCCRGTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link