znf503

Ensembl ID:
ENSDARG00000018492
ZFIN ID:
ZDB-GENE-031113-5
Description:
Zinc finger protein 503 [Source:UniProtKB/Swiss-Prot;Acc:Q6UFS5]
Human Orthologue:
ZNF503
Human Description:
zinc finger protein 503 [Source:HGNC Symbol;Acc:23589]
Mouse Orthologue:
Zfp503
Mouse Description:
zinc finger protein 503 Gene [Source:MGI Symbol;Acc:MGI:1353644]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11014 Nonsense Available for shipment Available now
sa19057 Nonsense Mutation detected in F1 DNA During 2018
sa12639 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11014
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008906 Nonsense 325 563 2 2
ENSDART00000008906 Nonsense 325 563 2 2
Genomic Location (Zv9):
Chromosome 13 (position 17519047)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 17339082
GRCz11 13 17470074
KASP Assay ID:
2260-6225.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGGCTATCCCCAACACTTCTTGCCCCACGGTGGAAGCCTGGTYAACGCA[C/T]AGCTCGCCAGCTCACTGGGCTGCAGTAAAGCWGGCTCRAGCCCTCTAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19057
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008906 Nonsense 325 563 2 2
ENSDART00000008906 Nonsense 325 563 2 2
Genomic Location (Zv9):
Chromosome 13 (position 17519047)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 17339082
GRCz11 13 17470074
KASP Assay ID:
2260-6225.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGGCTATCCCCAACACTTCTTGCCCCACGGTGGAAGCCTGGTCAACGCA[C/T]AGCTCGCCAGCTCACTGGGCTGCAGTAAAGCTGGCTCAAGCCCTCTAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12639
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008906 Nonsense 513 563 2 2
Genomic Location (Zv9):
Chromosome 13 (position 17519612)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 17339647
GRCz11 13 17470639
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCCCTGGGAGCCCCGGGACACTGGCACTCAGGAGCCCGCATCATGCGT[T/A]AGGACTAAGCAGCCGCTATCACCCGTATTCAAAGAGCCCGTTGCCTACTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link