zgc:56041

Ensembl ID:
ENSDARG00000018440
ZFIN IDs:
ZDB-GENE-040426-871, ZDB-GENE-040426-871
Description:
epidermal growth factor receptor kinase substrate 8 [Source:RefSeq peptide;Acc:NP_956536]
Human Orthologue:
EPS8
Human Description:
epidermal growth factor receptor pathway substrate 8 [Source:HGNC Symbol;Acc:3420]
Mouse Orthologue:
Eps8
Mouse Description:
epidermal growth factor receptor pathway substrate 8 Gene [Source:MGI Symbol;Acc:MGI:104684]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14811 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14811
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007012 Essential Splice Site 483 839 15 23
ENSDART00000122849 Essential Splice Site 468 804 15 21
ENSDART00000129833 Essential Splice Site 468 804 14 20
Genomic Location (Zv9):
Chromosome 19 (position 46917140)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 107535
GRCz11 4 161878
KASP Assay ID:
2261-3727.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTTCTCCYGCAGCAGCAGACAGTGCAGGATTTCAGCAGTRCAGACGG[G/A]TACGGCCTCACTCAYGCCACACACAAGCGTTTGCATCAGCTGGAGACAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link