
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
aldh7a1
- Ensembl ID:
- ENSDARG00000018426
- ZFIN ID:
- ZDB-GENE-030131-6129
- Description:
- alpha-aminoadipic semialdehyde dehydrogenase [Source:RefSeq peptide;Acc:NP_997889]
- Human Orthologue:
- ALDH7A1
- Human Description:
- aldehyde dehydrogenase 7 family, member A1 [Source:HGNC Symbol;Acc:877]
- Mouse Orthologue:
- Aldh7a1
- Mouse Description:
- aldehyde dehydrogenase family 7, member A1 Gene [Source:MGI Symbol;Acc:MGI:108186]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa45400 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa1371 | Essential Splice Site | Available for shipment | Available now |
sa41611 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa45400
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000122540 | Nonsense | 118 | 541 | 4 | 18 |
- Genomic Location (Zv9):
- Chromosome 10 (position 16048649)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 16061956 GRCz11 10 16020075 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGCTATGTGTTATTTAGGTACCTGCTCCAAAGAGAGGGGAAATTGTTCGA[C/T]AGATTGGAGAGGCTTTAAGGAGGAAGATCAAAGCTCTCGGCAGCTTAGTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa1371
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000122540 | Essential Splice Site | 293 | 541 | 9 | 18 |
- Genomic Location (Zv9):
- Chromosome 10 (position 16045925)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 16059232 GRCz11 10 16017351 - KASP Assay ID:
- 554-1283.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGCACTCATGTGGGCAAACAAGTGGCAATGATGGTACAAGAACGGTTTGG[T/C]GAGTTTTATGCATTACAATAGAATTTAATCGCAGTCTGTCATAATGTTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41611
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000122540 | Essential Splice Site | 498 | 541 | 16 | 18 |
- Genomic Location (Zv9):
- Chromosome 10 (position 16038489)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 16051796 GRCz11 10 16009915 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTGAACGTTAACATTCCTACTAGCGGTGCTGAGATTGGAGGAGCGTTTG[G/A]TGCGTATATTATACACCACACCATTCTAAAATTAACTAACTAAACTTACA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Osteoporosis: Genome-wide association study identifies ALDH7A1 as a novel susceptibility gene for osteoporosis. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: