wu:fk48d07

Ensembl ID:
ENSDARG00000018425
ZFIN ID:
ZDB-GENE-030131-6611
Human Orthologue:
DDX6
Human Description:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 6 [Source:HGNC Symbol;Acc:2747]
Mouse Orthologue:
Ddx6
Mouse Description:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 6 Gene [Source:MGI Symbol;Acc:MGI:104976]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22848 Essential Splice Site Available for shipment Available now
sa42727 Essential Splice Site Mutation detected in F1 DNA During 2018
sa22847 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22848
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114495 Essential Splice Site 59 483 1 23
Genomic Location (Zv9):
Chromosome 16 (position 27937038)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25782725
GRCz11 16 25697757
KASP Assay ID:
2260-9695.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATGCCCCAGAAAGGAAGCAGCATACCCCAAAGCAGTGGCGGTATCAGG[T/G]AATCTTCATGTAAAATATGGACTGAACTTTGTTTCTTTTAACATTGATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42727
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114495 Essential Splice Site 323 483 8 23
Genomic Location (Zv9):
Chromosome 16 (position 27929268)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25774955
GRCz11 16 25689987
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTGACGGAAAGACAGAAAGTGCACTGTCTCAATACACTGTTCTCCAGG[G/A]TAAGCAATTTGTTCTTCTACAGATGATGCCAAAGAAGCTTTGGTATAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22847
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114495 Essential Splice Site None 483 None 23

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 27916505)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25762192
GRCz11 16 25677224
KASP Assay ID:
2260-9694.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCGGTATTAGTGCACTGTTAATAAGGGCCTGTGTGAATGATGTGTTAC[A/T]GACACAGCAACACAAGTTTGTAAACTGGCAGTGTGATGGAGAGTATCGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link