sulf2

Ensembl ID:
ENSDARG00000018423
ZFIN ID:
ZDB-GENE-040426-759
Description:
sulfatase 2 [Source:RefSeq peptide;Acc:NP_957230]
Human Orthologue:
SULF2
Human Description:
sulfatase 2 [Source:HGNC Symbol;Acc:20392]
Mouse Orthologue:
Sulf2
Mouse Description:
sulfatase 2 Gene [Source:MGI Symbol;Acc:MGI:1919293]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35085 Nonsense Available for shipment Available now
sa13794 Nonsense Available for shipment Available now
sa17565 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35085
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008038 Nonsense 342 873 7 21
ENSDART00000131431   None 191 None 4
ENSDART00000145647   None 60 None 2

The following transcripts of ENSDARG00000018423 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 25909265)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24738090
GRCz11 11 24975706
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAGTTTGGGTTGGTCAAAGGCAAATCAATGCCATATGAGTTTGACATT[C/T]GAATCCCCTTCTACGTGCGAGGGCCCAACGTGGAAGCTGGTGCCATGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13794
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008038 Nonsense 631 873 13 21
ENSDART00000131431   None 191 None 4
ENSDART00000145647   None 60 None 2

The following transcripts of ENSDARG00000018423 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 25914536)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24743361
GRCz11 11 24980977
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACTAATGAAYGACACAGTTAAATGYGATGGTGGATTATATAAATCTCTA[C/T]AAGCATGGAAAGATCACAAACTACACATTGAGCATGAGGTGAGTTCACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17565
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008038 Nonsense 744 873 16 21
ENSDART00000131431   None 191 None 4
ENSDART00000145647   None 60 None 2

The following transcripts of ENSDARG00000018423 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 25916876)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24745701
GRCz11 11 24983317
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTGCAGCATGCCTGGSCTCACCTGCTTCACTCAMGACAACCAGCACTGG[C/T]AGACCGCCCCCTTCTGGACAAGTACTGCATTACATGCCACAGCTCTTCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link