TFR2 (2 of 2)

Ensembl ID:
ENSDARG00000018406
Description:
transferrin receptor 2 [Source:HGNC Symbol;Acc:11762]
Human Orthologue:
TFR2
Human Description:
transferrin receptor 2 [Source:HGNC Symbol;Acc:11762]
Mouse Orthologue:
Trfr2
Mouse Description:
transferrin receptor 2 Gene [Source:MGI Symbol;Acc:MGI:1354956]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38221 Nonsense Mutation detected in F1 DNA During 2018
sa30415 Missense, Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38221
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093150   None 547 None 16
ENSDART00000128022 Nonsense 232 428 6 10
Genomic Location (Zv9):
Chromosome Zv9_NA897 (position 5830)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 45243834
GRCz11 23 44959774
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGTGTGTGTGTGTGTGTCAGTGTTTATTCTGGCACATATATGAAGTG[G/A]TCAGATACGCACTGTAGCTACTTACAAATGCTAGACCATCTATGAAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30415
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093150 Nonsense 352 547 9 16
ENSDART00000128022 Missense 260 428 7 10
Genomic Location (Zv9):
Chromosome Zv9_NA897 (position 4671)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 45242675
GRCz11 23 44954731
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTACATTATTTCGTAGGGCTGCACAGTATTTTGCATTGCATTGTCGTTA[T/A]CACCATAGTAGTATATGCAATATTCGTATCGCAGACGTGTAATAATTTAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link