
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
hpca
- Ensembl ID:
- ENSDARG00000018397
- ZFIN ID:
- ZDB-GENE-040426-1683
- Description:
- neuron-specific calcium-binding protein hippocalcin [Source:RefSeq peptide;Acc:NP_957017]
- Human Orthologue:
- HPCA
- Human Description:
- hippocalcin [Source:HGNC Symbol;Acc:5144]
- Mouse Orthologue:
- Hpca
- Mouse Description:
- hippocalcin Gene [Source:MGI Symbol;Acc:MGI:1336200]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa1437 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa1437
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000004034 | Nonsense | 66 | 193 | 3 | 5 |
The following transcripts of ENSDARG00000018397 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 19 (position 34013708)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 33051124 GRCz11 19 32638244 - KASP Assay ID:
- 554-1364.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGAAGATCTATGCCAACTTCTTCCCGTATGGTGACGCCTCGAAGTTCGCA[G/T]AGCATGTCTTCCGTACATTTGACACCAACAAYGACGGCACCATCGATTTC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: