sult1st3

Ensembl ID:
ENSDARG00000018361
ZFIN ID:
ZDB-GENE-030804-28
Description:
Cytosolic sulfotransferase 3 [Source:UniProtKB/Swiss-Prot;Acc:Q7T2V2]
Human Orthologues:
SULT1A1, SULT1A2, SULT1A3, SULT1A4, SULT1B1, SULT1C3, SULT1E1
Human Descriptions:
sulfotransferase family 1E, estrogen-preferring, member 1 [Source:HGNC Symbol;Acc:11377]
sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 [Source:HGNC Symbol;Acc:11453]
sulfotransferase family, cytosolic, 1A, phenol-preferring, member 2 [Source:HGNC Symbol;Acc:11454]
sulfotransferase family, cytosolic, 1A, phenol-preferring, member 3 [Source:HGNC Symbol;Acc:11455]
sulfotransferase family, cytosolic, 1A, phenol-preferring, member 4 [Source:HGNC Symbol;Acc:30004]
sulfotransferase family, cytosolic, 1B, member 1 [Source:HGNC Symbol;Acc:17845]
sulfotransferase family, cytosolic, 1C, member 3 [Source:HGNC Symbol;Acc:33543]
Mouse Orthologues:
Sult1a1, Sult1b1, Sult1d1, Sult1e1
Mouse Descriptions:
sulfotransferase family 1A, phenol-preferring, member 1 Gene [Source:MGI Symbol;Acc:MGI:102896]
sulfotransferase family 1B, member 1 Gene [Source:MGI Symbol;Acc:MGI:2136282]
sulfotransferase family 1D, member 1 Gene [Source:MGI Symbol;Acc:MGI:1926341]
sulfotransferase family 1E, member 1 Gene [Source:MGI Symbol;Acc:MGI:98431]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa697 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa697
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014240 Nonsense 259 301 8 9
ENSDART00000030470 Nonsense 259 301 7 8
Genomic Location (Zv9):
Chromosome 8 (position 48713741)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 46551999
GRCz11 8 46559878
KASP Assay ID:
554-0605.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAACAAGATGACCAACTATTCCACTATCCCGGTCATGGACTTCAAGATCT[C/A]GCCCTTCATGCGGAAAGGTAAAAAAAACATCTAATTTTGCCTAAACCTAA
Associated Phenotype:
Data not yet available

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link