
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:56326
- Ensembl ID:
- ENSDARG00000018351
- ZFIN ID:
- ZDB-GENE-040426-986
- Description:
- 4-hydroxyphenylpyruvate dioxygenase [Source:UniProtKB/Swiss-Prot;Acc:Q6TGZ5]
- Human Orthologue:
- HPD
- Human Description:
- 4-hydroxyphenylpyruvate dioxygenase [Source:HGNC Symbol;Acc:5147]
- Mouse Orthologue:
- Hpd
- Mouse Description:
- 4-hydroxyphenylpyruvic acid dioxygenase Gene [Source:MGI Symbol;Acc:MGI:96213]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa15524 | Essential Splice Site | Available for shipment | Available now |
sa12093 | Essential Splice Site | Available for shipment | Available now |
sa3328 | Nonsense | F2 line generated | During 2018 |
Mutation Details
- Allele Name:
- sa15524
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000020472 | Essential Splice Site | 11 | 388 | 3 | 14 |
- Genomic Location (Zv9):
- Chromosome 5 (position 2807560)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 2553918 GRCz11 5 2824124 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTTCTCATTTTGGYASAAAATMTTACATKTGATGTTTTTCTTTCTGTTGC[A/T]GCCMGAGAGAGGRAAGTTTCTAAACTTTCACCATATCAAATTCTGGGTGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12093
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000020472 | Essential Splice Site | 81 | 388 | 6 | 14 |
- Genomic Location (Zv9):
- Chromosome 5 (position 2816253)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 2562611 GRCz11 5 2832817 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGTTMTAAAYAGAATATYACAATGTGAATTTAATAAATATCMTCCTGTTC[A/T]GAAATGGGGGAGCATMTGATAAAACAYGGAGACGGAGTCAAAGAYRTGGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa3328
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000020472 | Nonsense | 388 | 388 | 14 | 14 |
- Genomic Location (Zv9):
- Chromosome 5 (position 2835140)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 2581498 GRCz11 5 2851704 - KASP Assay ID:
- 554-2514.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CCATTGAGAAAGACCAGGAYGCCAGAGGAAACCTGACCGTCCTCAMAGCG[C/T]AGAACCAGAGCGTCTCCAAGGCTTTTCAATAAACACACACATGCGCACAY
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
- Urinary metabolites: A genome-wide association study of metabolic traits in human urine. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: