zgc:56326

Ensembl ID:
ENSDARG00000018351
ZFIN ID:
ZDB-GENE-040426-986
Description:
4-hydroxyphenylpyruvate dioxygenase [Source:UniProtKB/Swiss-Prot;Acc:Q6TGZ5]
Human Orthologue:
HPD
Human Description:
4-hydroxyphenylpyruvate dioxygenase [Source:HGNC Symbol;Acc:5147]
Mouse Orthologue:
Hpd
Mouse Description:
4-hydroxyphenylpyruvic acid dioxygenase Gene [Source:MGI Symbol;Acc:MGI:96213]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15524 Essential Splice Site Available for shipment Available now
sa12093 Essential Splice Site Available for shipment Available now
sa3328 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa15524
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020472 Essential Splice Site 11 388 3 14
Genomic Location (Zv9):
Chromosome 5 (position 2807560)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 2553918
GRCz11 5 2824124
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTCATTTTGGYASAAAATMTTACATKTGATGTTTTTCTTTCTGTTGC[A/T]GCCMGAGAGAGGRAAGTTTCTAAACTTTCACCATATCAAATTCTGGGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12093
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020472 Essential Splice Site 81 388 6 14
Genomic Location (Zv9):
Chromosome 5 (position 2816253)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 2562611
GRCz11 5 2832817
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTMTAAAYAGAATATYACAATGTGAATTTAATAAATATCMTCCTGTTC[A/T]GAAATGGGGGAGCATMTGATAAAACAYGGAGACGGAGTCAAAGAYRTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3328
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020472 Nonsense 388 388 14 14
Genomic Location (Zv9):
Chromosome 5 (position 2835140)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 2581498
GRCz11 5 2851704
KASP Assay ID:
554-2514.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATTGAGAAAGACCAGGAYGCCAGAGGAAACCTGACCGTCCTCAMAGCG[C/T]AGAACCAGAGCGTCTCCAAGGCTTTTCAATAAACACACACATGCGCACAY
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link