srl

Ensembl ID:
ENSDARG00000018306
ZFIN ID:
ZDB-GENE-061110-91
Description:
sarcalumenin [Source:RefSeq peptide;Acc:NP_001070999]
Human Orthologue:
SRL
Human Description:
sarcalumenin [Source:HGNC Symbol;Acc:11295]
Mouse Orthologue:
Srl
Mouse Description:
sarcalumenin Gene [Source:MGI Symbol;Acc:MGI:2146620]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40002 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40002
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004249 Nonsense 111 388 2 3
ENSDART00000123538   None 186 None 4
ENSDART00000124828 Nonsense 205 482 6 7
ENSDART00000129943 Nonsense 193 470 5 6
Genomic Location (Zv9):
Chromosome 3 (position 11063612)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 55903797
GRCz11 3 12134661
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACACTCGCTCCTGGAGAGGGTCACTTTTGTAGACACACCTGGAATCATT[G/T]AGAACCGCAAACAGCAAGAGAGAGGTACATGGTTTTCTCTACATTATCTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link