si:dkey-57a22.7

Ensembl ID:
ENSDARG00000018296
ZFIN ID:
ZDB-GENE-081105-180
Description:
si:dkey-57a22.7 [Source:RefSeq peptide;Acc:NP_001116772]
Human Orthologue:
REV1
Human Description:
REV1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:14060]
Mouse Orthologue:
Rev1
Mouse Description:
REV1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1929074]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2495 Essential Splice Site F2 line generated During 2018
sa27383 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa2495
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059652 Essential Splice Site 548 1261 8 21
ENSDART00000134915 Essential Splice Site 555 1268 9 22

The following transcripts of ENSDARG00000018296 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 22840843)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21996629
GRCz11 9 21807498
KASP Assay ID:
554-2822.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCTGCCCTTTCTATGGCAGAGATTGCMTCTTGTAGTTACGAGGCCAGG[T/G]AATTATTGCAAACCTGGCCACTTTCCTGCAACATGCTGCCCACAACAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27383
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059652 Essential Splice Site 972 1261 16 21
ENSDART00000134915 Essential Splice Site 979 1268 17 22

The following transcripts of ENSDARG00000018296 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 22846419)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 22002205
GRCz11 9 21813074
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCTAAAATATGAAATAAAATGGAAACCACTGTTTTCCCTTTGGTTTTA[G/T]GTGGACCCATCTGTTTTAAAAGCTTTACCTATAGACATAAGGAGACAAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link