wdr33

Ensembl ID:
ENSDARG00000018272
ZFIN ID:
ZDB-GENE-040924-3
Description:
WD repeat domain 33 (wdr33), transcript variant 2, mRNA [Source:RefSeq DNA;Acc:NM_001024221]
Human Orthologue:
WDR33
Human Description:
WD repeat domain 33 [Source:HGNC Symbol;Acc:25651]
Mouse Orthologue:
Wdr33
Mouse Description:
WD repeat domain 33 Gene [Source:MGI Symbol;Acc:MGI:1921570]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13555 Nonsense Available for shipment Available now
sa15874 Nonsense Available for shipment Available now
sa39759 Essential Splice Site Mutation detected in F1 DNA During 2018
sa7527 Missense Mutation detected in F1 DNA During 2018
sa32835 Nonsense Mutation detected in F1 DNA During 2018
sa31252 Nonsense Available for shipment Available now
sa39758 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa13555
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025131 Nonsense 27 1164 1 25
ENSDART00000124113 Nonsense 27 557 2 15
ENSDART00000138885 Nonsense 14 992 2 19
ENSDART00000025131 Nonsense 27 1164 1 25
ENSDART00000124113 Nonsense 27 557 2 15
ENSDART00000138885 Nonsense 14 992 2 19

The following transcripts of ENSDARG00000018272 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 5080241)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 5525969
GRCz11 2 5437851
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTTCCAYATGCCTCGCTTCCAGCACCAGGCTCYCCGWCAGCTGTTCTA[C/A]AAGAGGCCCGACTTCGCCCAGCAGCAGGCCATGCAGCAGCTCACCTTCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15874
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025131 Nonsense 27 1164 1 25
ENSDART00000124113 Nonsense 27 557 2 15
ENSDART00000138885 Nonsense 14 992 2 19
ENSDART00000025131 Nonsense 27 1164 1 25
ENSDART00000124113 Nonsense 27 557 2 15
ENSDART00000138885 Nonsense 14 992 2 19

The following transcripts of ENSDARG00000018272 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 5080241)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 5525969
GRCz11 2 5437851
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTTCCAYATGCCTCGCTTCCAGCACCAGGCTCYCCGWCAGCTGTTCTA[C/A]AAGAGGCCCGACTTCGCCCAGCAGCAGGCCATGCAGCAGCTCACCTTYGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39759
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025131 Essential Splice Site 91 1164 None 25
ENSDART00000124113 Essential Splice Site 91 557 None 15
ENSDART00000138885 Essential Splice Site 78 992 None 19

The following transcripts of ENSDARG00000018272 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 5079530)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 5525258
GRCz11 2 5437140
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATCGAGATTTCCGTGCTGTTCAACCAGACGCAGGCTGCTATAATGAAG[T/A]GAGTGTTTTACTACTACTGCTGCTATTTACAGTTATTGTGCGTGTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7527
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025131 Missense 151 1164 4 25
ENSDART00000124113 Missense 151 557 5 15
ENSDART00000138885 Missense 138 992 5 19

The following transcripts of ENSDARG00000018272 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 5077870)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 5523598
GRCz11 2 5435480
KASP Assay ID:
554-4298.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTAACAGGTGCCTCCAGTGGGGAGTTTACTTTATGGAAYGGGCTCACG[T/G]TCAACTTTGAGACAATTTTACAGGTAACCATAGAGAGACAYAACCTGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32835
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025131 Nonsense 549 1164 14 25
ENSDART00000124113 Nonsense 549 557 15 15
ENSDART00000138885 Nonsense 536 992 15 19

The following transcripts of ENSDARG00000018272 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 5065004)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 5510732
GRCz11 2 5422614
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAGCAAGAAGAAGACGCAAGCAGAGATTGAGCAGGAAATGGCTGCCCTG[C/T]AGTATACAAACCCAATGCTGCTCGAGGTCAGCAAATGTGCTACTTAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31252
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025131 Nonsense 708 1164 15 25
ENSDART00000124113   None 557 None 15
ENSDART00000138885 Nonsense 695 992 16 19

The following transcripts of ENSDARG00000018272 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 5064442)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 5510170
GRCz11 2 5422052
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGCTCTGGTGGACCTCCAGGCAGTATTATGGGACCACCGCCACGAGGA[C/T]AGGGTCCTCCACAAGGAAATATGATGCATCAGGACATGAGGGGGCCTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39758
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025131 Nonsense 823 1164 16 25
ENSDART00000124113   None 557 None 15
ENSDART00000138885 Nonsense 803 992 17 19

The following transcripts of ENSDARG00000018272 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 5062812)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 5508540
GRCz11 2 5420422
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCACATGTGTTCCAGGGTCAGAATCAGCCAATCATGCATGGAATAGGA[C/T]AGCAGGGTCCTAACGGAAAAGGTAATGCTCTGAATAGTGAATGCTTCAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link