zgc:101050

Ensembl ID:
ENSDARG00000018264
ZFIN ID:
ZDB-GENE-040801-100
Description:
hypothetical protein LOC445187 [Source:RefSeq peptide;Acc:NP_001003581]
Human Orthologue:
TRIM55
Human Description:
tripartite motif-containing 55 [Source:HGNC Symbol;Acc:14215]
Mouse Orthologue:
Trim55
Mouse Description:
tripartite motif-containing 55 Gene [Source:MGI Symbol;Acc:MGI:3036269]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa158 Nonsense Confirmed mutation in F2 line During 2018
sa43939 Nonsense Mutation detected in F1 DNA During 2018
sa8 Nonsense Available for shipment Available now
sa257 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa158
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002398 Nonsense 64 429 2 9
Genomic Location (Zv9):
Chromosome 23 (position 17631394)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 17534333
GRCz11 23 17460676
KASP Assay ID:
554-0019.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAGCATGCTGAGTAAGATGTGTAGCCGACTCTCTTCCAGGTTGGAATT[G/T]AAGGTAGTTTCCGCTGCCCTTCCTGTCGGCGTGAGGTCGTCTTGGGCCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43939
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002398 Nonsense 106 429 3 9
Genomic Location (Zv9):
Chromosome 23 (position 17629296)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 17532235
GRCz11 23 17458578
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAAAGATTTCTCTTTTAAATGTATCATATGTCAATGTGTCTTTAGCTA[T/G]AGGCCTCCACCGATGCCTCCTGCAGAGTTCAACTGTAAAGAGCATGAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002398 Nonsense 135 429 3 9
Genomic Location (Zv9):
Chromosome 23 (position 17629211)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 17532150
GRCz11 23 17458493
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAAAGAGCATGAAGATGAGAAGCTCAATATTTACTGTATCACGTGTCAG[C/T]AGCCGTCCTGCTCTCTCTGTAAGGTGTTTGGGGCACACAAGAACTGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa257
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002398 Nonsense 265 429 5 9
Genomic Location (Zv9):
Chromosome 23 (position 17628657)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 17531596
GRCz11 23 17457939
KASP Assay ID:
554-1760.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTGGACACAAACTCAAAGTTGATCCAGGCAGCCCAGAGTGCCATAGAC[G/T]AGCCTGAGATGGCTGCTTTTGTGCAGGTATAATCATCTTTTTTGCCTCCT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link