si:dkey-24g18.2

Ensembl ID:
ENSDARG00000018228
ZFIN ID:
ZDB-GENE-081104-48
Description:
5-hydroxytryptamine receptor 2C [Source:RefSeq peptide;Acc:NP_001123365]
Human Orthologue:
HTR2C
Human Description:
5-hydroxytryptamine (serotonin) receptor 2C [Source:HGNC Symbol;Acc:5295]
Mouse Orthologue:
Htr2c
Mouse Description:
5-hydroxytryptamine (serotonin) receptor 2C Gene [Source:MGI Symbol;Acc:MGI:96281]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13537 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13537
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024191 Nonsense 344 518 3 3
ENSDART00000134489 Nonsense 344 518 6 6
Genomic Location (Zv9):
Chromosome 7 (position 24659304)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 23221056
GRCz11 7 23492213
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCTCAAATGAWTTCACCCGCAGGACGGGACCCAGCTGGAGCTCATGGA[C/T]GACGGGGGATRATGCAGGCCATCAAGAACGAGCGGCGAGCATCCAAAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link