zgc:153923

Ensembl ID:
ENSDARG00000018159
ZFIN ID:
ZDB-GENE-061013-169
Description:
hypothetical protein LOC565195 [Source:RefSeq peptide;Acc:NP_001070850]
Human Orthologue:
ANO10
Human Description:
anoctamin 10 [Source:HGNC Symbol;Acc:25519]
Mouse Orthologue:
Ano10
Mouse Description:
anoctamin 10 Gene [Source:MGI Symbol;Acc:MGI:2143103]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32521 Nonsense Available for shipment Available now
sa38024 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa32521
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103831 Nonsense 202 691 5 13
ENSDART00000133789 Nonsense 202 691 7 15
ENSDART00000139290   None 116 None 3
ENSDART00000139970   None 55 None 5
ENSDART00000144426   None 77 None 5
Genomic Location (Zv9):
Chromosome 25 (position 13972180)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 13443755
GRCz11 25 13540155
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCCTCTGCATGATCAGGAGCGTCTGGCGGATCTGGGAAAGCAGTGGTA[C/A]TCGCAGAAGAGCCTATGGGGGCAACCGCTGGGTACAAACACACGTTCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38024
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103831 Nonsense 401 691 6 13
ENSDART00000133789 Nonsense 401 691 8 15
ENSDART00000139290   None 116 None 3
ENSDART00000139970   None 55 None 5
ENSDART00000144426   None 77 None 5
Genomic Location (Zv9):
Chromosome 25 (position 13968453)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 13440028
GRCz11 25 13536428
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATAAAGAATCAGGGTCGTATTTCACAGCTCCTTTGTTGTATCTGCCTT[C/A]GATCGCACATATAGTGTACACTAATGTGCTGGGGAATGTGTATCGCAACG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link