slc38a4

Ensembl ID:
ENSDARG00000018149
ZFIN ID:
ZDB-GENE-041010-14
Description:
solute carrier family 38, member 4 [Source:RefSeq peptide;Acc:NP_001005944]
Human Orthologue:
SLC38A4
Human Description:
solute carrier family 38, member 4 [Source:HGNC Symbol;Acc:14679]
Mouse Orthologue:
Slc38a4
Mouse Description:
solute carrier family 38, member 4 Gene [Source:MGI Symbol;Acc:MGI:1916604]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31368 Nonsense Available for shipment Available now
sa20170 Nonsense Available for shipment Available now
sa14136 Essential Splice Site Available for shipment Available now
sa31369 Nonsense Available for shipment Available now
sa2147 Nonsense F2 line generated During 2018
sa20171 Essential Splice Site Available for shipment Available now
sa25270 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa31368
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031135 Nonsense 51 310 3 11
ENSDART00000067446 Nonsense 63 538 3 16
Genomic Location (Zv9):
Chromosome 4 (position 1397964)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 1689596
GRCz11 4 1538909
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAAGTTTCTCACCAATGGCTTGATGAAGAAGAAGAAATATGAGGAATA[T/A]AATGAAGAATATGTAAGACTTTACTTCTGAAACACATTCATTATGTTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20170
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031135   None 310 None 11
ENSDART00000067446 Nonsense 197 538 8 16
Genomic Location (Zv9):
Chromosome 4 (position 1405664)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 1697296
GRCz11 4 1546609
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGATCATTTGTCTGTGTGTGTGCAGTGAATGGTATCTGAATGGGAATTA[T/A]GTGGTGGTGCTGGTGTCCATCGGCATCATTTTACCTCTATCTCTGCTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14136
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031135 Essential Splice Site 266 310 9 11
ENSDART00000067446 Essential Splice Site 382 538 12 16
Genomic Location (Zv9):
Chromosome 4 (position 1409751)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 1701383
GRCz11 4 1550696
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGTTATGTACCTGCTGTCTGCTCTCTTCGGTTATCTGACGTTTTATGG[T/A]ATGTCACACAMATTCNTTCATCGCTTCTTGTGTGTRTTGCCTCTTKKTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31369
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031135   None 310 None 11
ENSDART00000067446 Nonsense 440 538 14 16
Genomic Location (Zv9):
Chromosome 4 (position 1421004)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 1712636
GRCz11 4 1561949
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCGCTCGTCGGTCATCACGCTGTGTTTCGCAGGGAAAGAGTTCAGCTG[G/A]ATTCGACACTTCCTCATCGCCGCTGCTATTCTGGCCTTCAATAATCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2147
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031135   None 310 None 11
ENSDART00000067446 Nonsense 465 538 14 16
Genomic Location (Zv9):
Chromosome 4 (position 1421077)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 1712709
GRCz11 4 1562022
KASP Assay ID:
554-2526.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCTATTCTGGCCTTCAATAATCTGCTGGTGATCTTCGTGCCCACCATC[A/T]GAGACATCTTCGGCTTCATCGGTCAGCAGYTTGTGCTTGTTTGTGCACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20171
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031135   None 310 None 11
ENSDART00000067446 Essential Splice Site 504 538 15 16
ENSDART00000031135   None 310 None 11
ENSDART00000067446 Essential Splice Site 504 538 15 16
Genomic Location (Zv9):
Chromosome 4 (position 1421284)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 1712916
GRCz11 4 1562229
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGCGGCTGGTTAAGAGTTTACCAATGAAGTCTCCTCAAAAAATATCTG[T/A]AAGTACTTTTATTTCAGGTTTTGTTATTTTGATTTGTTTTATTTTTTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25270
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031135   None 310 None 11
ENSDART00000067446 Essential Splice Site 504 538 15 16
ENSDART00000031135   None 310 None 11
ENSDART00000067446 Essential Splice Site 504 538 15 16
Genomic Location (Zv9):
Chromosome 4 (position 1421284)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 1712916
GRCz11 4 1562229
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGCGGCTGGTTAAGAGTTTACCAATGAAGTCTCCTCAAAAAATATCTG[T/A]AAGTACTTTTATTTCAGGTTTTGTTATTTTGATTTGTTTTATTTTTTGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link