si:dkey-46k9.9

Ensembl ID:
ENSDARG00000018121
ZFIN ID:
ZDB-GENE-030131-6323
Human Orthologue:
CENPJ
Human Description:
centromere protein J [Source:HGNC Symbol;Acc:17272]
Mouse Orthologue:
Cenpj
Mouse Description:
centromere protein J Gene [Source:MGI Symbol;Acc:MGI:2684927]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41440 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41440
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028029 Essential Splice Site 945 1124 10 14
ENSDART00000140876 Essential Splice Site 945 1124 11 15
Genomic Location (Zv9):
Chromosome 9 (position 30606443)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29762389
GRCz11 9 29573135
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGACAGACAAATGAGAAACAGGAAGAAATCATGCAGTCAGACAGCAAG[G/A]TAATCAATCTGTCTTCTTCAGCTTCAACAATTCACATCTCAAATATTATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link