
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
cox5ab
- Ensembl ID:
- ENSDARG00000018119
- ZFIN ID:
- ZDB-GENE-030131-5162
- Description:
- Cox5ab protein [Source:UniProtKB/TrEMBL;Acc:Q6PBX0]
- Human Orthologue:
- COX5A
- Human Description:
- cytochrome c oxidase subunit Va [Source:HGNC Symbol;Acc:2267]
- Mouse Orthologue:
- Cox5a
- Mouse Description:
- cytochrome c oxidase, subunit Va Gene [Source:MGI Symbol;Acc:MGI:88474]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa43022 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa43022
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000011435 | Nonsense | 122 | 151 | 4 | 5 |
- Genomic Location (Zv9):
- Chromosome 18 (position 604366)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 893245 GRCz11 18 811588 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CACGGCTCTGCTGTTGTGTGTTTTGTCAGGATAAGTCTGGTCCTCATAAG[G/T]AGATCTACCCGTACGTGATCCAGGAGCTGAAGCCCACACTGCAGGAGCTG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Caffeine consumption: Genome-wide meta-analysis identifies regions on 7p21 (AHR) and 15q24 (CYP1A2) as determinants of habitual caffeine consumption. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: