si:dkey-225n3.4

Ensembl ID:
ENSDARG00000018066
ZFIN IDs:
ZDB-GENE-061220-1, ZDB-GENE-091204-98
Human Orthologue:
PTCHD1
Human Description:
patched domain containing 1 [Source:HGNC Symbol;Acc:26392]
Mouse Orthologue:
Ptchd1
Mouse Description:
patched domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2685233]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32488 Nonsense Available for shipment Available now
sa17881 Nonsense Available for shipment Available now
sa6773 Nonsense Mutation detected in F1 DNA During 2018
sa3274 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa32488
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026599 Nonsense 465 890 3 3
ENSDART00000137526   None 41 None 2
Genomic Location (Zv9):
Chromosome 24 (position 26305553)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 25208241
GRCz11 24 25353192
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCCCGAGCTGCTGCAGCAGAAGCCAGCATGGTACCGCTTTCTTATGTA[C/A]ACACATTACAACGAGGAGGCCACGGAAGCAGGACCCCTGTGTGCTTATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17881
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026599 Nonsense 549 890 3 3
ENSDART00000137526   None 41 None 2
Genomic Location (Zv9):
Chromosome 24 (position 26305803)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 25207991
GRCz11 24 25352942
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAATKTGGTTGCCACAGAAACAAGCACTAKAGCTTATACTCGTGCCCAA[C/T]AGCGGTATTTCAGTAGTTACAGTCCTGTGATCGGCTTCTACATCTATGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6773
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026599 Nonsense 575 890 3 3
ENSDART00000137526   None 41 None 2
Genomic Location (Zv9):
Chromosome 24 (position 26305881)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 25207913
GRCz11 24 25352864
KASP Assay ID:
554-5076.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATCGGCTTCTACATCTATGAGTCGATTGAGTACTGGAACACCAGTGTG[C/T]AAGAGGACCTACTAGAGTACATTAAAGGTTTTGAACGCATTTCCTGRTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3274
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026599 Nonsense 590 890 3 3
ENSDART00000137526   None 41 None 2
Genomic Location (Zv9):
Chromosome 24 (position 26305928)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 25207866
GRCz11 24 25352817
KASP Assay ID:
554-3178.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCAAGAGGACCTACTAGAGTACATTAAAGGTTTTGAACGCATTTCCTG[G/A]TTCGAGAGTTACCTTAACTATCTTCATGGGCTGAACATCACTACTAGCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link