zgc:136773

Ensembl ID:
ENSDARG00000018049
ZFIN ID:
ZDB-GENE-070928-1
Description:
splicing factor 3B subunit 2 [Source:RefSeq peptide;Acc:NP_001098747]
Human Orthologue:
SF3B2
Human Description:
splicing factor 3b, subunit 2, 145kDa [Source:HGNC Symbol;Acc:10769]
Mouse Orthologue:
Sf3b2
Mouse Description:
splicing factor 3b, subunit 2 Gene [Source:MGI Symbol;Acc:MGI:2441856]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8422 Essential Splice Site Mutation detected in F1 DNA During 2018
sa40832 Essential Splice Site Mutation detected in F1 DNA During 2018
sa38593 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa8422
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015873 Essential Splice Site 48 826 2 22
Genomic Location (Zv9):
Chromosome 7 (position 7562065)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 6621152
GRCz11 7 6756850
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RTCCAGGTCCAAGAGAGGAGCTCATAGACAGACTGAAATCTTRTGCACAG[G/A]TAAATTAGTTAAGGKTTTTAATTACAGATACRACGTTATTTACRNTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40832
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015873 Essential Splice Site 120 826 5 22
Genomic Location (Zv9):
Chromosome 7 (position 7564841)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 6623928
GRCz11 7 6759626
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCTATGGAGCCACCGGGTATGATGCAGCATGACGACAGGGGCCCACAG[G/T]TAAGAGACAGAAGCTGCATCCCAAATCGCATACTTATGCACTATTCTGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38593
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015873 Essential Splice Site 232 826 9 22
Genomic Location (Zv9):
Chromosome 7 (position 7573981)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 6633068
GRCz11 7 6768766
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCAAACTGTCTCATGATTAAGTTTCTGTCTTTTGTCTCCTGTTATTTC[A/G]GAGGATGATGATGATGATGATCTCGCGGAGCTGACTAATATTCACGGATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link