zgc:171704

Ensembl ID:
ENSDARG00000018048
ZFIN ID:
ZDB-GENE-070820-16
Description:
hypothetical protein LOC100124619 [Source:RefSeq peptide;Acc:NP_001096115]
Human Orthologue:
RERGL
Human Description:
RERG/RAS-like [Source:HGNC Symbol;Acc:26213]
Mouse Orthologue:
Rergl
Mouse Description:
RERG/RAS-like Gene [Source:MGI Symbol;Acc:MGI:3642998]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36165 Essential Splice Site Mutation detected in F1 DNA During 2018
sa22865 Nonsense Available for shipment Available now
sa12436 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36165
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027417 Essential Splice Site 57 218 2 4
Genomic Location (Zv9):
Chromosome 16 (position 31020713)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28857831
GRCz11 16 28792454
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGTGCGTTTTCTCACCAGAAGATTCATTGGAGAATATGGGGATATTGG[T/G]ACGTATTTGCTGTAAAAACATTCATAATAGACCCACAATACATTTTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22865
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027417 Nonsense 117 218 4 4
Genomic Location (Zv9):
Chromosome 16 (position 31022062)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28859180
GRCz11 16 28793803
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGATCCTGGTCTACAGCATCTGCGACCACTCCAGCTTTGAGGTGGTC[C/T]GACAACAGGTGCAGCTCATCCGCCAAACCAGAAAGCTCTCCGCATCCGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12436
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027417 Nonsense 119 218 4 4
Genomic Location (Zv9):
Chromosome 16 (position 31022068)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28859186
GRCz11 16 28793809
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TYCTGGTCTACAGCATCTGCGACCACTCCAGCTTTGAGGTGGTCCGACAA[C/T]AGGTGCAGCTCATCCGCCAAACCAGAAAGCTYTCCGCATCCGTACCCATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link