tbx2a

Ensembl ID:
ENSDARG00000018025
ZFIN ID:
ZDB-GENE-990917-4
Description:
T-box gene 2a [Source:RefSeq peptide;Acc:NP_001095854]
Human Orthologue:
TBX2
Human Description:
T-box 2 [Source:HGNC Symbol;Acc:11597]
Mouse Orthologue:
Tbx2
Mouse Description:
T-box 2 Gene [Source:MGI Symbol;Acc:MGI:98494]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31478 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31478
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024207 Essential Splice Site 258 686 3 7
Genomic Location (Zv9):
Chromosome 5 (position 57920619)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 55841218
GRCz11 5 56511435
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTCCCCGAGACCGATTTTATAGCTGTCACTGCATATCAGAATGACAAG[G/A]TAAGTTGGAGTACTTAAACGTAGCTTAAAAGGTGTGTTTTTATTTGGCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link