zgc:153922

Ensembl ID:
ENSDARG00000018008
ZFIN ID:
ZDB-GENE-060929-384
Description:
Putative malate dehydrogenase 1B [Source:UniProtKB/Swiss-Prot;Acc:Q08BZ4]
Human Orthologue:
MDH1B
Human Description:
malate dehydrogenase 1B, NAD (soluble) [Source:HGNC Symbol;Acc:17836]
Mouse Orthologue:
Mdh1b
Mouse Description:
malate dehydrogenase 1B, NAD (soluble) Gene [Source:MGI Symbol;Acc:MGI:1923918]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19411 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19411
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103710 Essential Splice Site 45 447 None 10
ENSDART00000141653 Essential Splice Site 52 454 None 10

The following transcripts of ENSDARG00000018008 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 5088260)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 5526822
GRCz11 1 6224600
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTGATTTTCACATCCACAAGATCCCTGTGCCGCCCGATGACTGGAAGG[T/C]AAACCTGGATGTTTAAGAGCTCTTTAATCAGTTGTACACATGCTGAAATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link