vrk1

Ensembl ID:
ENSDARG00000018006
ZFIN ID:
ZDB-GENE-040426-2709
Description:
Serine/threonine-protein kinase VRK1 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZUS1]
Human Orthologue:
VRK1
Human Description:
vaccinia related kinase 1 [Source:HGNC Symbol;Acc:12718]
Mouse Orthologue:
Vrk1
Mouse Description:
vaccinia related kinase 1 Gene [Source:MGI Symbol;Acc:MGI:1261847]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23040 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23040
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045991 Nonsense 53 425 2 13
Genomic Location (Zv9):
Chromosome 17 (position 18624336)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 18774347
GRCz11 17 18794183
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATGGAAGCTTGGATCAGCTGTTGGACAAGGAGGTTTTGGCCTGCTGTA[T/A]CTTGGTAAGATAAAGAAAAAAGCCAAAGGAAATTCATTCCTTTTCCTTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Platelet counts: Duffy-null-associated low neutrophil counts influence HIV-1 susceptibility in high-risk South African black women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link