si:dkey-121j17.2

Ensembl ID:
ENSDARG00000017988
ZFIN ID:
ZDB-GENE-041001-202
Description:
dermatan-sulfate epimerase [Source:RefSeq peptide;Acc:NP_001025396]
Human Orthologue:
DSE
Human Description:
dermatan sulfate epimerase [Source:HGNC Symbol;Acc:21144]
Mouse Orthologue:
Dse
Mouse Description:
dermatan sulfate epimerase Gene [Source:MGI Symbol;Acc:MGI:2443455]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45685 Nonsense Mutation detected in F1 DNA During 2018
sa36930 Splice Site, Nonsense Mutation detected in F1 DNA During 2018
sa32267 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45685
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010474 Nonsense 129 949 1 5
Genomic Location (Zv9):
Chromosome 20 (position 557126)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 550401
GRCz11 20 540248
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATGTTCTGCATGCTGTACCCGCACCGCGCCGGGGCTCTGGACGTAGCC[A/T]AGGAATACATGGAGCGCATGGCCGCACAGCCCAACTGGTAAAAGTTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36930
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010474 Splice Site, Nonsense 375 949 5 5
Genomic Location (Zv9):
Chromosome 20 (position 571505)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 564780
GRCz11 20 554627
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCATATTTTGAGTTGAGCACAAAACGTCTGTTTCGTTCCCATTTTACAG[G/A]TATGATGCCAGTCTGCGGCCGACCCCACCTCCTGATTATGGAACATCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32267
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010474 Nonsense 798 949 5 5
Genomic Location (Zv9):
Chromosome 20 (position 572773)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 566048
GRCz11 20 555895
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAGACAAGAGGAAGACCTCTGGGAATATCCAGAAGATGTTTTCCCTTT[C/A]GAAGAAGAAGGGGAAAGGAGGCAAGAAGACCAGCTTCTCCGACAGCCTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link