vps13d

Ensembl ID:
ENSDARG00000017986
ZFIN ID:
ZDB-GENE-050912-1
Human Orthologue:
VPS13D
Human Description:
vacuolar protein sorting 13 homolog D (S. cerevisiae) [Source:HGNC Symbol;Acc:23595]
Mouse Orthologue:
Vps13d
Mouse Description:
vacuolar protein sorting 13 D (yeast) Gene [Source:MGI Symbol;Acc:MGI:2448530]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9084 Nonsense Mutation detected in F1 DNA During 2018
sa37692 Nonsense Mutation detected in F1 DNA During 2018
sa16971 Nonsense Available for shipment Available now
sa45002 Nonsense Mutation detected in F1 DNA During 2018
sa37691 Nonsense Mutation detected in F1 DNA During 2018
sa551 Essential Splice Site F2 line generated During 2018
sa31088 Essential Splice Site Mutation detected in F1 DNA During 2018
sa43971 Essential Splice Site Mutation detected in F1 DNA During 2018
sa24315 Essential Splice Site Available for shipment Available now
sa24314 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9084
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046613 Nonsense 1277 4361 18 68
ENSDART00000145408 Nonsense 1272 2099 19 25
ENSDART00000148128   None 2233 None 44
Genomic Location (Zv9):
Chromosome 23 (position 22049007)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21828314
GRCz11 23 21754865
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATGGWGYGGCATTCTTTCCYATTGCTGGCATGACTCCTTCCGAAGCTT[T/A]AAGTTTCCGCTTTATGGAAAAATCTCAAGGAGAATGCTCCCTTCAACTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37692
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046613 Nonsense 1526 4361 19 68
ENSDART00000145408 Nonsense 1521 2099 20 25
ENSDART00000148128   None 2233 None 44
Genomic Location (Zv9):
Chromosome 23 (position 22048132)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21827439
GRCz11 23 21753990
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCACTGTCGAGAAAGTCCCTGTTGACGAAAACTCTACCTTTACCTTTT[T/A]GTCTTGTGATGAACCTTACCAGAGCACAGGGATATTAAGAGTAGAAGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16971
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046613 Nonsense 1530 4361 19 68
ENSDART00000145408 Nonsense 1525 2099 20 25
ENSDART00000148128   None 2233 None 44
Genomic Location (Zv9):
Chromosome 23 (position 22048121)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21827428
GRCz11 23 21753979
KASP Assay ID:
2261-7661.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAAGTCCCTGWTGACGAAAACTCTACCTTTACCTTTTTGTCTTGTGAT[G/T]AACCTTACCAGAGCACAGGGATATTAAGAGTAGAAGGCAAATTTGTTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45002
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046613 Nonsense 2008 4361 23 68
ENSDART00000145408 Nonsense 2003 2099 24 25
ENSDART00000148128   None 2233 None 44
Genomic Location (Zv9):
Chromosome 23 (position 22046330)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21825637
GRCz11 23 21752188
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCGAGAATATGATATGAAGGTGTCTCTACAGATGGCCTCAGTACAGTA[T/A]GTCCATACGCAGCGCTTCCAGGCTGAGGTAGTGGCCTTTATCCAACACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37691
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046613 Nonsense 2158 4361 26 68
ENSDART00000145408   None 2099 None 25
ENSDART00000148128 Nonsense 5 2233 1 44
Genomic Location (Zv9):
Chromosome 23 (position 22042934)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21822241
GRCz11 23 21748792
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTTACCCAGAGAAATTTAATTTATATGTGTTACAGAAGACCATGTGTG[T/A]CTGCTGGACTGTATAGCACTTGACCTTCAAGAGATGGACATTTTTGCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa551
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046613 Essential Splice Site 2321 4361 28 68
ENSDART00000145408   None 2099 None 25
ENSDART00000148128 Essential Splice Site 168 2233 3 44
Genomic Location (Zv9):
Chromosome 23 (position 22040491)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21819798
GRCz11 23 21746349
KASP Assay ID:
554-0461.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTACTGGACAACCATAAATCCACAGGTCATAACTGCTCCTTGGCAAGG[T/C]ACATCGTTCATTCAGAATTCTTTATTTTCCTGCACTTTTTCATAGACTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31088
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046613 Essential Splice Site 2768 4361 36 68
ENSDART00000145408   None 2099 None 25
ENSDART00000148128 Essential Splice Site 615 2233 11 44
ENSDART00000046613 Essential Splice Site 2768 4361 36 68
ENSDART00000145408   None 2099 None 25
ENSDART00000148128 Essential Splice Site 615 2233 11 44
Genomic Location (Zv9):
Chromosome 23 (position 22037282)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21816589
GRCz11 23 21743140
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGCTAGTTTCACATTGTCTGGAGATTATTACAACAGGGAACTCTCAGG[T/C]GAGATCTTGGTATAGCTGTCATCCTGAATGTCAGTTAGCCAGTCCCTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43971
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046613 Essential Splice Site 2768 4361 36 68
ENSDART00000145408   None 2099 None 25
ENSDART00000148128 Essential Splice Site 615 2233 11 44
ENSDART00000046613 Essential Splice Site 2768 4361 36 68
ENSDART00000145408   None 2099 None 25
ENSDART00000148128 Essential Splice Site 615 2233 11 44
Genomic Location (Zv9):
Chromosome 23 (position 22037282)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21816589
GRCz11 23 21743140
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGCTAGTTTCACATTGTCTGGAGATTATTACAACAGGGAACTCTCAGG[T/C]GAGATCTTGGTATAGCTGTCATCCTGAATGTCAGTTAGCCAGTCCCTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24315
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046613 Essential Splice Site 3317 4361 47 68
ENSDART00000145408   None 2099 None 25
ENSDART00000148128 Essential Splice Site 1189 2233 23 44
Genomic Location (Zv9):
Chromosome 23 (position 22026609)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21805916
GRCz11 23 21732467
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTGAGCCCATTGCTCTTCTGCTACACTGACAAAGAGCAGCCCAATATG[T/C]GAGTTCAAAAGAAAAGGCTCTCATCAGATGCTTTTGAAAATCTAACTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24314
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046613 Nonsense 3909 4361 60 68
ENSDART00000145408   None 2099 None 25
ENSDART00000148128 Nonsense 1781 2233 36 44
Genomic Location (Zv9):
Chromosome 23 (position 22016470)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21795777
GRCz11 23 21722328
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGATCATAGATGTTGCACTCTGATTCACAGCATCTGATGGTCACAGCT[C/T]GACGCTACACTGTAATCATAGAGGAGAAGCTCTTAATGAAACTGCTGATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link