si:dkey-69h9.1

Ensembl ID:
ENSDARG00000017982
ZFIN ID:
ZDB-GENE-041014-339
Description:
24-hydroxycholesterol 7-alpha-hydroxylase [Source:RefSeq peptide;Acc:NP_001025360]
Human Orthologue:
CYP39A1
Human Description:
cytochrome P450, family 39, subfamily A, polypeptide 1 [Source:HGNC Symbol;Acc:17449]
Mouse Orthologue:
Cyp39a1
Mouse Description:
cytochrome P450, family 39, subfamily a, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:1927096]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23779 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23779
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005764 Nonsense 174 464 4 12
Genomic Location (Zv9):
Chromosome 20 (position 39239700)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 39312112
GRCz11 20 39214991
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTATCTTATTTACAGGAGTGTGATGTATCCGTCAGTGATGAGCAATT[T/A]ACTAGGCCGCTGTAATTCGCCCAGCAGCGCTCTCAGCAGGCAGGAGTTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link