si:dkeyp-116g9.2

Ensembl ID:
ENSDARG00000017886
ZFIN IDs:
ZDB-GENE-030131-2398, ZDB-GENE-030131-5055
Description:
Zinc finger protein ZNF-U69274 [Source:UniProtKB/TrEMBL;Acc:Q6TNP6]
Human Orthologue:
ZBTB11
Human Description:
zinc finger and BTB domain containing 11 [Source:HGNC Symbol;Acc:16740]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17282 Nonsense Available for shipment Available now
sa2282 Essential Splice Site F2 line generated During 2018
sa14905 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17282
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110288 Nonsense 741 1146 6 10

The following transcripts of ENSDARG00000017886 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 28866144)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 29161787
GRCz11 6 29152348
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACAGAAGATTCTCAGRGCTCAGATGATCAGGCCAGATTTCGCACCAGA[C/T]GAGAGTTYGTGTGYGAYATCTGTGGCAAGACTATGCCYAAGCTGTACTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2282
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110288 Essential Splice Site 822 1146 6 10

The following transcripts of ENSDARG00000017886 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 28865897)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 29161540
GRCz11 6 29152101
KASP Assay ID:
554-2458.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTTTCGTCACCAAAAGAAGCCTGGAGGAACATACAAGCATTCATACAG[G/A]TACACTCGCATGTCTTTTGCTTGTGTCAGACGAACAGGTGCAACACAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14905
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110288 Nonsense 1119 1146 10 10

The following transcripts of ENSDARG00000017886 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 28859138)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 29154781
GRCz11 6 29145342
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACTCTCTCTGATCAGAGCATCATGCAGGTGGTCAATTACGTCCTGGCA[C/T]AGCAGGCTGCAGTTAAAGTGGAAGAGGCTCCAGAGATCAWCCARACCATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link