srsf1b

Ensembl ID:
ENSDARG00000017843
ZFIN ID:
ZDB-GENE-040426-1467
Description:
Serine/arginine-rich splicing factor 1B [Source:UniProtKB/Swiss-Prot;Acc:Q6NYA0]
Human Orthologue:
SRSF1
Human Description:
serine/arginine-rich splicing factor 1 [Source:HGNC Symbol;Acc:10780]
Mouse Orthologue:
Srsf1
Mouse Description:
serine/arginine-rich splicing factor 1 Gene [Source:MGI Symbol;Acc:MGI:98283]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12863 Nonsense Available for shipment Available now
sa12123 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12863
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110646 Nonsense 84 258 2 6
ENSDART00000140865 Nonsense 21 125 1 2
ENSDART00000143566 Nonsense 21 182 1 3

The following transcripts of ENSDARG00000017843 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 38410910)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 39530989
GRCz11 21 39576047
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGATGCTGTATATGGAYGTGATGGCTATGACTATGACGGCTATCRTCTT[C/T]GAGTGGAGTTCCCAAGGAGTGGCAGGGGAGGTGGAAGAGGTGGAGGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12123
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110646 Essential Splice Site None 258 None 6
ENSDART00000140865   None 125 None 2
ENSDART00000143566   None 182 3 3

The following transcripts of ENSDARG00000017843 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 38405041)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 39525120
GRCz11 21 39570178
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATATGTGGAGGAGGAGGAGGAGCAGGCATTTCATTTAAGGAGGCAATGG[T/C]ATGACGGCAAGCAGCTTTAGTCACATTCAAAAMGGCAGTTGATGTTTTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link