zgc:152927

Ensembl ID:
ENSDARG00000017813
ZFIN ID:
ZDB-GENE-060929-436
Description:
GPI transamidase component PIG-S [Source:RefSeq peptide;Acc:NP_001070082]
Human Orthologue:
PIGS
Human Description:
phosphatidylinositol glycan anchor biosynthesis, class S [Source:HGNC Symbol;Acc:14937]
Mouse Orthologue:
Pigs
Mouse Description:
phosphatidylinositol glycan anchor biosynthesis, class S Gene [Source:MGI Symbol;Acc:MGI:2687325]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24014 Nonsense Available for shipment Available now
sa24013 Nonsense Available for shipment Available now
sa17168 Essential Splice Site Available for shipment Available now
sa14851 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa24014
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076031 Nonsense 103 566 3 11
Genomic Location (Zv9):
Chromosome 21 (position 38438710)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 39580277
GRCz11 21 39603847
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAAACACATTCTCTATTTCTCTTTCTAGCTAAGACAAGTTTGAGGTAC[C/T]AATATGAAACCAGATACCGCACTGCTACTGTTATGGAAGAAGACGCCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24013
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076031 Nonsense 215 566 5 11
Genomic Location (Zv9):
Chromosome 21 (position 38432786)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 39552683
GRCz10 21 39574353
GRCz11 21 39597923
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATGTCTTTCAGTCATCAAGATATTACAGCAGCTCTGAGCGACCGAGTC[C/T]GAATGACCAAAGTGACCAAGGAGAGTATGGCAGACAGCATGAGGGCCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17168
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076031 Essential Splice Site 322 566 7 11
Genomic Location (Zv9):
Chromosome 21 (position 38428011)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 39548081
GRCz10 21 39569578
GRCz11 21 39593148
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGCRGACAGCCTKTCTCATGTCATCAATCCCGTGGAGGCCAGACTAGG[T/C]GAAATATGATTCTTTTAATTGACATGAACTGATCTAAGGAAATATTTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14851
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076031 Nonsense 532 566 11 11
Genomic Location (Zv9):
Chromosome 21 (position 38418699)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 39538770
GRCz10 21 39560266
GRCz11 21 39583836
KASP Assay ID:
1641-0484.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCTTTTGCATCTGCTTTACTTTCCAGATGATCAGAAGTTTGCCATCTA[C/A]ATTCCTCTCTTCCTTCCCATGTGTGTGCCTATTGTGCTCTCGCTGCTCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link