
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
bcor
- Ensembl ID:
- ENSDARG00000017798
- ZFIN ID:
- ZDB-GENE-040408-1
- Description:
- BCL-6 corepressor [Source:RefSeq peptide;Acc:NP_991189]
- Human Orthologue:
- BCOR
- Human Description:
- BCL6 corepressor [Source:HGNC Symbol;Acc:20893]
- Mouse Orthologue:
- Bcor
- Mouse Description:
- BCL6 interacting corepressor Gene [Source:MGI Symbol;Acc:MGI:1918708]
Alleles
There are 7 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa24091 | Nonsense | Available for shipment | Available now |
sa37445 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa43784 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa32384 | Nonsense | Available for shipment | Available now |
sa24092 | Essential Splice Site | Available for shipment | Available now |
sa37446 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa12397 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa24091
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000047442 | Nonsense | 355 | 1777 | 3 | 13 |
ENSDART00000102106 | Nonsense | 355 | 1796 | 3 | 14 |
- Genomic Location (Zv9):
- Chromosome 22 (position 11265620)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 11125788 GRCz11 22 11155470 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TAGTACTATGGAGTTCCAGAAGCCTCTGTACAGAAGTCCTTCCTCATCCT[C/A]ATCATCTTCACCATCAGTATCTCACCCTGTCTATATTAGCAGTGCATCCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37445
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000047442 | Nonsense | 758 | 1777 | 3 | 13 |
ENSDART00000102106 | Nonsense | 758 | 1796 | 3 | 14 |
- Genomic Location (Zv9):
- Chromosome 22 (position 11266830)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 11126998 GRCz11 22 11156680 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTGAGGCCCAGAACCCTGGACAAGACTTGGCACCATGATGAGCCTCCTTA[T/G]AAGCGCCAGAGCATCACTGACATAGACCCAGACTACAAATCTGAGAAGGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa43784
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000047442 | Nonsense | 938 | 1777 | 3 | 13 |
ENSDART00000102106 | Nonsense | 938 | 1796 | 3 | 14 |
- Genomic Location (Zv9):
- Chromosome 22 (position 11267368)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 11127536 GRCz11 22 11157218 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGGCTCGAGCTGATGGAGCTGAATTCAGAGTTGATCGGCACCACACTAAT[C/T]GACAATATGTGGACCTGGGCAAGGATGGACTTGAAGACACAGAGTCCCAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32384
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000047442 | Nonsense | 981 | 1777 | 3 | 13 |
ENSDART00000102106 | Nonsense | 981 | 1796 | 3 | 14 |
- Genomic Location (Zv9):
- Chromosome 22 (position 11267499)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 11127667 GRCz11 22 11157349 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAAGGAAAGAGATCCAGCTTGGCCAAGAGAATAGCCAACTCCTCAGGCTA[T/A]GTTGGCGACCGCTTCAAGTGCGTCACCACAGAGTTGTATGCAGACTCCAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa24092
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000047442 | Essential Splice Site | 1630 | 1777 | 12 | 13 |
ENSDART00000102106 | Essential Splice Site | 1649 | 1796 | 13 | 14 |
- Genomic Location (Zv9):
- Chromosome 22 (position 11302984)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 11163152 GRCz11 22 11192834 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATTCACACCTTGTCTCTCATTTCTAATCGATATCTGTCTCTCTGACTCAC[A/T]GAGCCTGCCGACGACTCGTCTGGGTACGATATCCTGGCCAACCCTCCCGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37446
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000047442 | Essential Splice Site | 1680 | 1777 | None | 13 |
ENSDART00000102106 | Essential Splice Site | 1699 | 1796 | None | 14 |
- Genomic Location (Zv9):
- Chromosome 22 (position 11309608)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 11169776 GRCz11 22 11199458 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTGCTCTCATTTTCAGCTAATTAATCTCTCTTTCTCCCGCTCTTGTTCAC[A/C]GACCCAGAAATTGGTTGCTGCTCTCAGATGTCCTCAAGCGACTGAAGATG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12397
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000047442 | Nonsense | 1770 | 1777 | 13 | 13 |
ENSDART00000102106 | Nonsense | 1789 | 1796 | 14 | 14 |
- Genomic Location (Zv9):
- Chromosome 22 (position 11309878)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 11170046 GRCz11 22 11199728 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGCTGGTGGCGCTGCTGGGGTCATCGATTGAATGCTTGGACGACCGCTGG[G/T]AACCCGCTTCCAGACCTCGCTCCTGAACTATTGCACACGCACTCGGACAG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Smooth-surface caries : Genome-wide association studies of pit-and-fissure- and smooth-surface caries in permanent dentition. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: