zgc:77033

Ensembl ID:
ENSDARG00000017757
ZFIN ID:
ZDB-GENE-040426-2532
Description:
phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma isoform [Source:RefSeq pepti
Human Orthologue:
PIK3CG
Human Description:
phosphoinositide-3-kinase, catalytic, gamma polypeptide [Source:HGNC Symbol;Acc:8978]
Mouse Orthologue:
Pik3cg
Mouse Description:
phosphoinositide-3-kinase, catalytic, gamma polypeptide Gene [Source:MGI Symbol;Acc:MGI:1353576]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15462 Nonsense Available for shipment Available now
sa40205 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa15462
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009076 Nonsense 76 1098 2 11
Genomic Location (Zv9):
Chromosome 4 (position 3222471)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 3338273
GRCz11 4 3351600
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTRGACGTRACTGGAAATTGGACGGTAGAGCAGGTGAAGGTTCAGCTTTG[G/A]CACAGAGCGGTAACCTCTAAGTTATGCCCTGAATTTTACCAAAAATACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40205
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009076 Nonsense 725 1098 4 11
Genomic Location (Zv9):
Chromosome 4 (position 3220084)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 3335886
GRCz11 4 3349213
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCTGTAATACTGGAAGCGTATCTCCGTGGCTGTGGTGAAGAAATGCTA[C/T]AGGACTTCAGGAAGCAGGTGGAGATCACAGAGGCCTTGCAAAAGGTCGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Blood pressure: Genome-wide association study identifies six new loci influencing pulse pressure and mean arterial pressure. (View Study)
  • Carotid intima media thickness: Meta-analysis of genome-wide association studies from the CHARGE consortium identifies common variants associated with carotid intima media thickness and plaque. (View Study)
  • Mean platelet volume: A genome-wide meta-analysis identifies 22 loci associated with eight hematological parameters in the HaemGen consortium. (View Study)
  • Mean platelet volume: A meta-analysis and genome-wide association study of platelet count and mean platelet volume in african americans. (View Study)
  • Platelet counts: New gene functions in megakaryopoiesis and platelet formation. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link