smc2

Ensembl ID:
ENSDARG00000017744
ZFIN ID:
ZDB-GENE-030131-105
Description:
structural maintenance of chromosomes 2 [Source:RefSeq peptide;Acc:NP_955836]
Human Orthologue:
SMC2
Human Description:
structural maintenance of chromosomes 2 [Source:HGNC Symbol;Acc:14011]
Mouse Orthologue:
Smc2
Mouse Description:
structural maintenance of chromosomes 2 Gene [Source:MGI Symbol;Acc:MGI:106067]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11231 Essential Splice Site Available for shipment Available now
sa11094 Essential Splice Site Available for shipment Available now
sa13643 Essential Splice Site, Missense Available for shipment Available now

Mutation Details

Allele Name:
sa11231
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008616 Essential Splice Site 511 1232 11 26
ENSDART00000109416 Essential Splice Site 511 1199 11 24

The following transcripts of ENSDARG00000017744 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 18290634)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18855802
GRCz11 1 19548739
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTATGAGTCCCTCATGGGCCAATTCCCCAACCTGCGCTTTGAATAYACG[T/G]GAGGACTTGCAAGATGTTTTCATCTAGACAGTGTGTCAATTATAGACTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11094
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008616 Essential Splice Site 1092 1232 23 26
ENSDART00000109416 Essential Splice Site 1090 1199 23 24

The following transcripts of ENSDARG00000017744 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 18299834)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18865002
GRCz11 1 19557939
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTGTGCATATGCYGCTCATTGATCATCTGATGCATTTGTGTGTGTTTC[A/T]GGTCTCTGGTGGCGCTCTCTCTGATTTTAGCTATGTTGCTCTTTAAACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13643
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008616 Essential Splice Site 1189 1232 24 26
ENSDART00000109416 Missense 1188 1199 24 24

The following transcripts of ENSDARG00000017744 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 18303281)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18868449
GRCz11 1 19561386
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TKCTCARACACACGAGGGGAAGGTTTTGGCTCAGCGCACACAGGAGAAAG[C/T]CAAGGACAAACGGCAGCGGCAGATACTGGCCAGCTAAAYACTTTYCTCTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link