ak5l

Ensembl ID:
ENSDARG00000017739
ZFIN ID:
ZDB-GENE-050410-2
Description:
adenylate kinase 5, like [Source:RefSeq peptide;Acc:NP_001017540]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33751 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa33751
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029364 Essential Splice Site 141 335 3 8
Genomic Location (Zv9):
Chromosome 5 (position 67455382)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 63505989
GRCz11 5 64187188
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGTCTTTGACCCTTCGAAACCACGACCGCACATCATCTTCATTATAGG[T/C]GCACTTAACAATGCTTTTCTTGAAATGTTTAGTTAAAGTGTATATAAAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link