
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-106h11.1
- Ensembl ID:
- ENSDARG00000017720
- ZFIN ID:
- ZDB-GENE-061009-2
- Description:
- Novel protein similar to vertebrate leucine rich repeat containing 8 family [Source:UniProtKB/TrEMBL
- Human Orthologues:
- LRRC8A, LRRC8B, LRRC8C, LRRC8D, LRRC8E
- Human Descriptions:
- leucine rich repeat containing 8 family, member A [Source:HGNC Symbol;Acc:19027]
- leucine rich repeat containing 8 family, member B [Source:HGNC Symbol;Acc:30692]
- leucine rich repeat containing 8 family, member C [Source:HGNC Symbol;Acc:25075]
- leucine rich repeat containing 8 family, member D [Source:HGNC Symbol;Acc:16992]
- leucine rich repeat containing 8 family, member E [Source:HGNC Symbol;Acc:26272]
- Mouse Orthologues:
- Lrrc8a, Lrrc8b, Lrrc8c, Lrrc8d, Lrrc8e
- Mouse Descriptions:
- leucine rich repeat containing 8 family, member B Gene [Source:MGI Symbol;Acc:MGI:2141353]
- leucine rich repeat containing 8 family, member C Gene [Source:MGI Symbol;Acc:MGI:2140839]
- leucine rich repeat containing 8 family, member E Gene [Source:MGI Symbol;Acc:MGI:1919517]
- leucine rich repeat containing 8A Gene [Source:MGI Symbol;Acc:MGI:2652847]
- leucine rich repeat containing 8D Gene [Source:MGI Symbol;Acc:MGI:1922368]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa12678 | Nonsense | Available for shipment | Available now |
sa19935 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa12678
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000009883 | None | 808 | None | 7 | |
ENSDART00000145866 | Nonsense | 192 | 857 | 2 | 6 |
- Genomic Location (Zv9):
- Chromosome 3 (position 6179249)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 5751692 GRCz11 3 5661613 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTGAATTGTTGAWTATGTCTAGGTAGCTTCATCGTACAAAATGCGCAAGT[C/A]GAGTTTGGACTCGGGAACGGACAGCCYTCTGCTGGCAGGAATTGACACTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19935
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000009883 | Nonsense | 520 | 808 | 6 | 7 |
ENSDART00000145866 | Nonsense | 551 | 857 | 5 | 6 |
- Genomic Location (Zv9):
- Chromosome 3 (position 6170170)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 5742613 GRCz11 3 5652534 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACTCTCTGCGGGGCCTTCAGGAGCTCCAGCTGACGGGGCGGCTGGGCAGC[G/T]AGGGCGGGATGGGGCGCGGATGGACCCTCGGAAGTCTCCGACAGCTGCGG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: