cirh1a

Ensembl ID:
ENSDARG00000017675
ZFIN ID:
ZDB-GENE-040426-2466
Description:
cirhin [Source:RefSeq peptide;Acc:NP_998447]
Human Orthologue:
CIRH1A
Human Description:
cirrhosis, autosomal recessive 1A (cirhin) [Source:HGNC Symbol;Acc:1983]
Mouse Orthologue:
Cirh1a
Mouse Description:
cirrhosis, autosomal recessive 1A (human) Gene [Source:MGI Symbol;Acc:MGI:1096573]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23255 Essential Splice Site Available for shipment Available now
sa2978 Essential Splice Site F2 line generated During 2018
sa36595 Nonsense Mutation detected in F1 DNA During 2018
sa6505 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa23255
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010821 Essential Splice Site 116 685 3 17
Genomic Location (Zv9):
Chromosome 18 (position 14207681)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 14653099
GRCz11 18 14621611
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGCCAATCTGGGCCATAACAGGCAATCAACAAGGAACACACTTGGCGG[T/C]AAGTTTGGTTTGTTTACTACGATCATGTATTCAATAATTCAAAAACATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2978
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010821 Essential Splice Site 303 685 7 17
ENSDART00000010821 Essential Splice Site 303 685 7 17
Genomic Location (Zv9):
Chromosome 18 (position 14211069)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 14656487
GRCz11 18 14624999
KASP Assay ID:
554-3265.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGATGTTCGAGCTGTGGCTGAGATCACAACAGCTGTGGTTTCAGGAGG[C/A]GAGTTAATTTTTTTCATTTAATAGTTAAAACAGTCAATCTATCAGTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36595
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010821 Nonsense 412 685 11 17
Genomic Location (Zv9):
Chromosome 18 (position 14213823)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 14659241
GRCz11 18 14627753
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCGTGTCTCCCTGTGGTGAATGGATTGCGTACTCGACCACCAGCAGTT[T/A]ACGCCTCTACAAGCTACACTGCGACAGTAACAACGTCAGCATCACCAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6505
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010821 Nonsense 539 685 14 17
Genomic Location (Zv9):
Chromosome 18 (position 14216282)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 14661700
GRCz11 18 14630212
KASP Assay ID:
554-5048.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATACAGTTCAGCTGTCAGTGCCATGGCCATCCATCCAACAACAAACTG[T/A]CTGTTCATGGTTCATGCAGATCAACAGGTAATCTGCAACCTGCACATRAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link