sps2

Ensembl ID:
ENSDARG00000017659
ZFIN ID:
ZDB-GENE-030327-5
Description:
selenophosphate synthetase 2 [Source:RefSeq peptide;Acc:NP_001004295]
Human Orthologue:
SEPHS2
Human Description:
selenophosphate synthetase 2 [Source:HGNC Symbol;Acc:19686]
Mouse Orthologue:
Sephs2
Mouse Description:
selenophosphate synthetase 2 Gene [Source:MGI Symbol;Acc:MGI:108388]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24292 Nonsense Available for shipment Available now
sa32437 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24292
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004655 Nonsense 270 344 8 8
Genomic Location (Zv9):
Chromosome 23 (position 18733779)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 18636718
GRCz11 23 18563061
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGGTGGTCTGTTGATCTGTTTGCCACGGGAGCAAGCAGCCCGGTTTTG[C/A]GCAGAGATGAAATCCAGCCGCATGGGTTTGCTGGGAGCTGGGCAGGATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32437
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004655 Nonsense 294 344 8 8
Genomic Location (Zv9):
Chromosome 23 (position 18733709)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 18636648
GRCz11 23 18562991
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATGGGTTTGCTGGGAGCTGGGCAGGATGGAGGGGTGGGCGATGGGCAA[C/T]AAGCTTGGATCATTGGCATCGTGGAGAAGGGCAATCGCTGCGCCCGCATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link