zgc:63569

Ensembl ID:
ENSDARG00000017554
ZFIN ID:
ZDB-GENE-030131-9816
Description:
Choline transporter-like protein 2 [Source:UniProtKB/Swiss-Prot;Acc:Q7SYC9]
Human Orthologue:
SLC44A2
Human Description:
solute carrier family 44, member 2 [Source:HGNC Symbol;Acc:17292]
Mouse Orthologue:
Slc44a2
Mouse Description:
solute carrier family 44, member 2 Gene [Source:MGI Symbol;Acc:MGI:1915932]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24830 Essential Splice Site Available for shipment Available now
sa39508 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa24830
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015507 Essential Splice Site 26 644 2 20
Genomic Location (Zv9):
Chromosome Zv9_NA203 (position 27668)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149859.1 27668
GRCz11 KN149859.1 27668
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAGCCGAGGAAATTCGACCCCAGCTTCAAAGGGCCCATCCAAAACAGG[T/C]AAGAGAAATTCCATGCAAATGTCAACCTTGCTTTGAAAGAAAGTTAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39508
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015507 Nonsense 153 644 7 20
Genomic Location (Zv9):
Chromosome Zv9_NA203 (position 33179)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149859.1 33179
GRCz11 KN149859.1 33179
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCATCTTCTTTTAAAGGCTGCTGCGCAAATTTTGAAAGAGAAGCTCTG[T/A]CCAGCATATCTGGTTTCCAGCAATCCATGTAAGACCGGTCTTCATATTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link