zgc:123068

Ensembl ID:
ENSDARG00000017489
ZFIN ID:
ZDB-GENE-051030-98
Description:
putative ISG12-1 protein [Source:RefSeq peptide;Acc:NP_001007133]
Human Orthologues:
IFI27, IFI27L1, IFI27L2, IFI6
Human Descriptions:
interferon, alpha-inducible protein 27 [Source:HGNC Symbol;Acc:5397]
interferon, alpha-inducible protein 27-like 1 [Source:HGNC Symbol;Acc:19754]
interferon, alpha-inducible protein 27-like 2 [Source:HGNC Symbol;Acc:19753]
interferon, alpha-inducible protein 6 [Source:HGNC Symbol;Acc:4054]
Mouse Orthologues:
Ifi27l1, Ifi27l2a, Ifi27l2b
Mouse Descriptions:
interferon, alpha-inducible protein 27 like 1 Gene [Source:MGI Symbol;Acc:MGI:1277180]
interferon, alpha-inducible protein 27 like 2A Gene [Source:MGI Symbol;Acc:MGI:1924183]
interferon, alpha-inducible protein 27 like 2B Gene [Source:MGI Symbol;Acc:MGI:1916390]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38967 Nonsense Mutation detected in F1 DNA During 2018
sa8700 Essential Splice Site Mutation detected in F1 DNA During 2018
sa8727 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38967
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046945 Nonsense 27 95 3 4
ENSDART00000140230 Nonsense 27 95 4 5

The following transcripts of ENSDARG00000017489 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 38003595)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37480407
GRCz11 13 37606297
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGAGCAATTGCTGCAGCTCCTGCACTTCTAACAGCTGCAGGTTTCACT[G/T]GAGCTGGCATTGCTGCAGGATCAGTTGCCTCCTGGATGATGTCAACAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8700
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046945 Essential Splice Site 64 95 3 4
ENSDART00000140230 Essential Splice Site 64 95 4 5
ENSDART00000046945 Essential Splice Site 64 95 3 4
ENSDART00000140230 Essential Splice Site 64 95 4 5

The following transcripts of ENSDARG00000017489 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 38003482)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37480294
GRCz11 13 37606184
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGGAGGAGTCGCTGCTGGATCRGCGGKTGCTGTTCTTCAAAGCGCAGG[T/G]GAGTAAAATTCCTCAAATGAGTYAAAATGATTAATGCATGGAATAAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8727
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046945 Essential Splice Site 64 95 3 4
ENSDART00000140230 Essential Splice Site 64 95 4 5
ENSDART00000046945 Essential Splice Site 64 95 3 4
ENSDART00000140230 Essential Splice Site 64 95 4 5

The following transcripts of ENSDARG00000017489 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 38003482)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37480294
GRCz11 13 37606184
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGGAGGAGTCGCTGCTGGATCRGCGGKTGCTGTTCTTCAAAGCGCAGG[T/G]GAGTAAAATTCCTCAAATGAGTYAAAATGATTAATGCATGGAATAAAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link